Skip to content

Painslibrary

Painslibrary

  • Home
  • Blog
  • Front Page
  • Sample Page
Uncategorized

Quantitative Structure Activity Relationship (QSAR) study predicts small molecule binding to RNA structure

Chemexpress November 19, 2024 0 Comments

The diversity of RNA structural elements and their documented role in human diseases make RNA an attractive therapeutic target. However, progress in drug discovery and development has been hindered by…

Uncategorized

Discovery of Innovative Polymers for Next-Generation Gas-Separation Membranes using Interpretable Machine Learning

Chemexpress November 19, 2024 0 Comments

Polymer membranes perform innumerable separations with far-reaching environmentalimplications. Despite decades of research on membrane technologies, design of new membranematerials remains a largely Edisonian process. To address this shortcoming, we demonstrate…

Uncategorized

Bayesian active learning of interatomic force field for molecular dynamics simulation of Pt/Ag(111)

Chemexpress November 19, 2024 0 Comments

Force field is a central requirement in molecular dynamics (MD) simulation for accurate description of the potential energy landscape and the time evolution of individual atomic motions. Most energy models…

Uncategorized

Out with Acetonitrile: Water-assisted Accelerated-Aging Synthesis of CuI-Pyrazine Hybrid Materials

Chemexpress November 19, 2024 0 Comments

CuI and pyrazine form three hybrid materials, (Yellow), (Orange), and (Red). In this work, Red was prepared using a green synthetic method, water-assisted accelerated-aging synthesis, for the first time. The…

Uncategorized

Balancing high energy density and chemical stability in redox flow batteries with symmetric tetrazines

Chemexpress November 18, 2024 0 Comments

Nonaqueous redox flow batteries are a promising technology for grid-scale energy storage, however, their commercial success relies on identifying redox active materials that exhibit extreme potentials, high solubilities in all…

Uncategorized

Light-driven charge accumulation of a molecular Cu(I) {complex|complicated} for storage of photoredox equivalents

Chemexpress November 18, 2024 0 Comments

The diurnal day/night cycle is presently of {great|fantastic|excellent|wonderful|good|terrific} interest for harvesting solar {energy|power} aimed at rendering {suitable|appropriate} {energy|power} storage schemes. To this {end|finish} we present a noble-metal {free|totally free|free of…

Uncategorized

Solvation structure and dynamics of Li and LiO2 and their transformation in non-aqueous organic electrolyte solvents from first-principles simulations

Chemexpress November 18, 2024 0 Comments

Density functional theory calculations together with ab initio molecular dynamics (AIMD) simulations have been used to study the solvation, diffusion and transformation of Li+ and LiO2 upon O2 reduction in…

Uncategorized

Organocatalytic Silicon-Free SuFEx reactions for modular synthesis of sulfonate esters and sulfonamides

Chemexpress November 18, 2024 0 Comments

Sulfur(VI) fluoride exchange (SuFEx) click chemistry provides a powerful tool for rapid construction of modular connections. Here, we report a novel catalytic silicon-free SuFEx reaction with sulfonyl fluorides. Under the…

Uncategorized

An Environmentally Benign Supercapacitor Using A Water-dissolvable Ionic Gel

Chemexpress November 18, 2024 0 Comments

An environmentally benign supercapacitor is developed incorporating an ionic liquid, carbon powder, a cellulose separator and a Molybdenum electrode. The ionic liquid is dispersed into a water-dissolvable polymer, poly(vinyl alcohol),…

Uncategorized

Synthetic Studies with the Brevicidine and Laterocidine Lipopeptide Antibiotics Including Analogues with Enhanced Properties and in vivo Efficacy

Chemexpress November 18, 2024 0 Comments

Brevicidine and laterocidine are two recently discovered lipopeptide antibiotics with promising antibacterial activity. Possessing a macrocyclic core, multiple positive charges, and a lipidated N-terminus, these lipopeptides exhibit potent and selective…

Posts pagination

1 … 72 73 74 … 173

« Previous Page — Next Page »

Recent Posts

  • For the NanT function is restricted to firmicutes and also the noted
  • E extracted and searched applying Spectrum Mill Proteomics Workbench software program (version
  • two M of LPA for 96 hours. Stimulation with ten New Born Calf Serum
  • N within the inset of Fig. 5B) is Ip= eight.8857C309.0143 with
  • GAGGGTAAAATGCAGA AGGACTGGGAGCGGGTGTA GCCTTTACGATCCGCTGTACC ACCTGGACGCTGAATGCAA GCTGAGGGTGTCGAAGAGGT TTAGTTGGCCATTCCAGGAC CTCTCCTCTCCAGTACGTCCTTCC CCGTTCTTCATCCAGGTGATdoi:ten.1371/journal.pone.0095539.tPLOS

Recent Comments

No comments to show.

You Missed

Uncategorized

For the NanT function is restricted to firmicutes and also the noted

Uncategorized

E extracted and searched applying Spectrum Mill Proteomics Workbench software program (version

Uncategorized

two M of LPA for 96 hours. Stimulation with ten New Born Calf Serum

Uncategorized

N within the inset of Fig. 5B) is Ip= eight.8857C309.0143 with

Painslibrary

Copyright © All rights reserved | Blogus by Themeansar.