Skip to content

Painslibrary

Painslibrary

  • Home
  • Blog
  • Front Page
  • Sample Page
    • Home
    • Chemexpress
    • Page 17
Uncategorized

NEDL2 Rabbit Polyclonal Antibody

Chemexpress March 19, 2025 0 Comments

Product Name : NEDL2 Rabbit Polyclonal AntibodyPredicted band size : Observed band size : Synonyms: C2 and WW domain-containing protein 2 antibody E3 ubiquitin protein ligase HECW2 antibody E3 ubiquitin-protein…

Uncategorized

NDUFA4 Rabbit Polyclonal Antibody

Chemexpress March 14, 2025 0 Comments

Product Name : NDUFA4 Rabbit Polyclonal AntibodyPredicted band size : Observed band size : Synonyms: CI 9k antibody CI-MLRQ antibody Complex I 9kDa subunit antibody Complex I-MLRQ antibody MLRQ antibody…

Uncategorized

NAPSIN A Mouse Monoclonal Antibody [A9C4]

Chemexpress March 13, 2025 0 Comments

Product Name : NAPSIN A Mouse Monoclonal Antibody Predicted band size : Observed band size : Synonyms: Asp 4 antibody ASP4 antibody Aspartyl protease 4 antibody KAP antibody Kdap antibody…

Uncategorized

NF-kappaB p105/p50 Rabbit Polyclonal Antibody

Chemexpress March 12, 2025 0 Comments

Product Name : NF-kappaB p105/p50 Rabbit Polyclonal AntibodyPredicted band size : Observed band size : Synonyms: DKFZp686C01211 antibody DNA binding factor KBF1 antibody DNA binding factor KBF1 EBP1 antibody DNA-binding…

Uncategorized

NEGR1 Rabbit Polyclonal Antibody

Chemexpress March 11, 2025 0 Comments

Product Name : NEGR1 Rabbit Polyclonal AntibodyPredicted band size : Observed band size : Synonyms: A kindred of IgLON antibody DMML2433 antibody IgLON family member 4 antibody IGLON4 antibody KILON…

Uncategorized

NCAM1 Recombinant Rabbit Monoclonal Antibody [PSH06-53]

Chemexpress March 10, 2025 0 Comments

Product Name : NCAM1 Recombinant Rabbit Monoclonal Antibody Predicted band size : 95 kDaObserved band size : 120-250 kDaSynonyms: antigen MSK39 identified by monoclonal antibody 5.1H11 antibody antigen recognized by…

Uncategorized

NEIL1 Rabbit Polyclonal Antibody

Chemexpress March 9, 2025 0 Comments

Product Name : NEIL1 Rabbit Polyclonal AntibodyPredicted band size : Observed band size : Synonyms: DNA (apurinic or apyrimidinic site) lyase Neil1 antibody DNA glycosylase/AP lyase Neil 1 antibody DNA…

Uncategorized

Mre11 Recombinant Rabbit Monoclonal Antibody [JM11-18]

Chemexpress March 8, 2025 0 Comments

Product Name : Mre11 Recombinant Rabbit Monoclonal Antibody Predicted band size : 81 kDaObserved band size : 81 kDaSynonyms: AT like disease antibody Ataxia telangiectasia disorder like antibody ATLD antibody…

Uncategorized

Myelin Protein Zero Rabbit Polyclonal Antibody

Chemexpress March 4, 2025 0 Comments

Product Name : Myelin Protein Zero Rabbit Polyclonal AntibodyPredicted band size : Observed band size : Synonyms: Charcot Marie Tooth neuropathy 1B antibody CHM antibody CMT1 antibody CMT1B antibody CMT2I…

Uncategorized

MyoD1/Myf3 Rabbit Polyclonal Antibody

Chemexpress March 3, 2025 0 Comments

Product Name : MyoD1/Myf3 Rabbit Polyclonal AntibodyPredicted band size : Observed band size : Synonyms: bHLHc1 antibody Class C basic helix-loop-helix protein 1 antibody MYF 3 antibody Myf-3 antibody MYF3…

Posts pagination

1 … 16 17 18 … 173

« Previous Page — Next Page »

Recent Posts

  • For the NanT function is restricted to firmicutes and also the noted
  • E extracted and searched applying Spectrum Mill Proteomics Workbench software program (version
  • two M of LPA for 96 hours. Stimulation with ten New Born Calf Serum
  • N within the inset of Fig. 5B) is Ip= eight.8857C309.0143 with
  • GAGGGTAAAATGCAGA AGGACTGGGAGCGGGTGTA GCCTTTACGATCCGCTGTACC ACCTGGACGCTGAATGCAA GCTGAGGGTGTCGAAGAGGT TTAGTTGGCCATTCCAGGAC CTCTCCTCTCCAGTACGTCCTTCC CCGTTCTTCATCCAGGTGATdoi:ten.1371/journal.pone.0095539.tPLOS

Recent Comments

No comments to show.

You Missed

Uncategorized

For the NanT function is restricted to firmicutes and also the noted

Uncategorized

E extracted and searched applying Spectrum Mill Proteomics Workbench software program (version

Uncategorized

two M of LPA for 96 hours. Stimulation with ten New Born Calf Serum

Uncategorized

N within the inset of Fig. 5B) is Ip= eight.8857C309.0143 with

Painslibrary

Copyright © All rights reserved | Blogus by Themeansar.