Skip to content

Painslibrary

Painslibrary

  • Home
  • Blog
  • Front Page
  • Sample Page
    • Home
    • Chemexpress
    • Page 14
Uncategorized

Pyruvate Dehydrogenase E2 Recombinant Rabbit Monoclonal Antibody [JE34-38]

Chemexpress May 27, 2025 0 Comments

Product Name : Pyruvate Dehydrogenase E2 Recombinant Rabbit Monoclonal Antibody Predicted band size : 69 kDaObserved band size : 69 kDaSynonyms: 70 kDa mitochondrial autoantigen of primary biliary cirrhosis antibody…

Uncategorized

Phospho-Rb (S780) Recombinant Rabbit Monoclonal Antibody [JE44-61]

Chemexpress May 26, 2025 0 Comments

Product Name : Phospho-Rb (S780) Recombinant Rabbit Monoclonal Antibody Predicted band size : 106 kDaObserved band size : 106 kDaSynonyms: Exon 17 tumor GOS561 substitution mutation causes premature stop antibody…

Uncategorized

Phospho-PTEN (S380) Recombinant Rabbit Monoclonal Antibody [JJ08-81]

Chemexpress May 25, 2025 0 Comments

Product Name : Phospho-PTEN (S380) Recombinant Rabbit Monoclonal Antibody Predicted band size : Observed band size : Synonyms: 10q23del antibody BZS antibody DEC antibody GLM2 antibody MGC11227 antibody MHAM antibody…

Uncategorized

Phospho-GluR1 (S845) Recombinant Rabbit Monoclonal Antibody [JJ2009]

Chemexpress May 24, 2025 0 Comments

Product Name : Phospho-GluR1 (S845) Recombinant Rabbit Monoclonal Antibody Predicted band size : 102 kDaObserved band size : 102 kDaSynonyms: GLUR 1 antibody GLUR A antibody AMPA 1 antibody AMPA…

Uncategorized

Phospho-AMPK alpha 1 (S496) Recombinant Rabbit Monoclonal Antibody [SD0810]

Chemexpress May 23, 2025 0 Comments

Product Name : Phospho-AMPK alpha 1 (S496) Recombinant Rabbit Monoclonal Antibody Predicted band size : 64 kDaObserved band size : 64 kDaSynonyms: 5 AMP activated protein kinase alpha 1catalytic subunit…

Uncategorized

Pan-Lactyl-lysine Recombinant Rabbit Monoclonal Antibody [PSH03-74]

Chemexpress May 22, 2025 0 Comments

Product Name : Pan-Lactyl-lysine Recombinant Rabbit Monoclonal Antibody Predicted band size : Observed band size : Mutiple kDaSynonyms: Lactyllysine antibodyFunction : Post-translational modifications (PTMs) represent a crucial means of regulating…

Uncategorized

PSMD11 Rabbit Polyclonal Antibody

Chemexpress May 21, 2025 0 Comments

Product Name : PSMD11 Rabbit Polyclonal AntibodyPredicted band size : 47 kDaObserved band size : 47/100 kDaSynonyms: 26S proteasome non-ATPase regulatory subunit 11 antibody 26S proteasome regulatory subunit 9 antibody…

Uncategorized

PPP4R1L Rabbit Polyclonal Antibody

Chemexpress May 20, 2025 0 Comments

Product Name : PPP4R1L Rabbit Polyclonal AntibodyPredicted band size : Observed band size : Synonyms: PPP4R1L antibody C20orf192 antibody Putative serine/threonine-protein phosphatase 4 regulatory subunit 1-like antibodyFunction : May be…

Uncategorized

PLCG2 Rabbit Polyclonal Antibody

Chemexpress May 19, 2025 0 Comments

Product Name : PLCG2 Rabbit Polyclonal AntibodyPredicted band size : Observed band size : Synonyms: 1 phosphatidylinositol 4 5 bisphosphate phosphodiesterase gamma 2 antibody 1-phosphatidylinositol-4 antibody 5-bisphosphate phosphodiesterase gamma-2 antibody…

Uncategorized

PICALM Recombinant Rabbit Monoclonal Antibody [PSH01-64]

Chemexpress May 18, 2025 0 Comments

Product Name : PICALM Recombinant Rabbit Monoclonal Antibody Predicted band size : 71 kDaObserved band size : 65/71 kDaSynonyms: CALM antibody Clathrin assembly lymphoid myeloid leukemia antibody Clathrin assembly lymphoid…

Posts pagination

1 … 13 14 15 … 173

« Previous Page — Next Page »

Recent Posts

  • For the NanT function is restricted to firmicutes and also the noted
  • E extracted and searched applying Spectrum Mill Proteomics Workbench software program (version
  • two M of LPA for 96 hours. Stimulation with ten New Born Calf Serum
  • N within the inset of Fig. 5B) is Ip= eight.8857C309.0143 with
  • GAGGGTAAAATGCAGA AGGACTGGGAGCGGGTGTA GCCTTTACGATCCGCTGTACC ACCTGGACGCTGAATGCAA GCTGAGGGTGTCGAAGAGGT TTAGTTGGCCATTCCAGGAC CTCTCCTCTCCAGTACGTCCTTCC CCGTTCTTCATCCAGGTGATdoi:ten.1371/journal.pone.0095539.tPLOS

Recent Comments

No comments to show.

You Missed

Uncategorized

For the NanT function is restricted to firmicutes and also the noted

Uncategorized

E extracted and searched applying Spectrum Mill Proteomics Workbench software program (version

Uncategorized

two M of LPA for 96 hours. Stimulation with ten New Born Calf Serum

Uncategorized

N within the inset of Fig. 5B) is Ip= eight.8857C309.0143 with

Painslibrary

Copyright © All rights reserved | Blogus by Themeansar.